Understanding DNA

Coat Of Arms ~  Early Arrivals ~ 7 Gold Cities ~ Understanding DNA ~ Fam Tree Gallery ~ Feedback ~ Index

Join the Ramos Project at: http://www.familytreedna.com/surname_join.asp?code=L33071
 

. . . . . . . . . . . . Ponder this, when looking at tombstones for family roots:         "Prefiero buscar a los muertos que los muertos me busquen a mí."  "I rather look for the dead than the dead look for me." . .   . . . . . . . . . .		What is DNA?  DeoxyriboNucleic Acid The DNA letters stand for: G = Guanine     C = Cytosine A = Adenine     T = Thymine   The DNA strand is made of letters:  ATGCTCGAATAAATGTCAATTTGA The letters make words: ATG CTC GAA TAA ATG TCA ATT TGA The words make sentences: <ATG CTC GAA TAA> <ATG TCA ATT TGA> The sentences are called genes. Genes tell the cell to make other molecules called proteins. Proteins enable a cell to perform special functions.  Such as (cells in the ear)  working with other groups of cells to make hearing possible.   DNA 101 = For a basic review of DNA, genes, chromosomes, heredity, and traits visit the University of Utah Genetic Science Learning Center. Transcribe and Translate a Gene = http://gslc.genetics.utah.edu/units/basics/transcribe/  DNA Mutations = http://evolution.berkeley.edu/evolibrary/article/mutations_01                         http://en.wikipedia.org/wiki/DNA Wikipedia The Free Encyclopedia         The DNA Ramos Project is open to all Ramos Surname individuals wanting to learn about their genealogy.  Click on this link.
		Testing the Y-Chromosome The Y-Chromosome has definable segments of DNA with known genetic characteristics. These segments are known as Markers. These markers occur at an identifiable physical location on a chromosome known as a Locus. Each marker is designated by a number known as D = DNA: Y = Chromosome; S = Single copy sequence or simply DYS#, according to international conventions. You will often find the terms Marker and Locus used interchangeably, but technically the Marker is what is tested and the Locus is where the marker is located on the chromosome. Although there are several types of markers used in DNA studies, the Y-Chromosome test uses only one type. The marker used is called a Short Tandem Repeat (STR). STRs are short sequences of DNA, (usually 2, 3, 4, or 5 base pairs long), that are repeated numerous times in a head-tail manner. The 16 base pair sequence of "gatagatagatagata" would represent 4 repeats of the sequence "gata". These repeats are referred to as Allele. The variation of the number of repeats of each marker enables discrimination between individuals. The following graphic of a DNA Double Helix will give you a more complex explanation... Click of the graphic.
DNA 101  is an attempt to take the extremely complex and confusing subject of Genetics and DNA and simplify it into layman terms. This page addresses DNA only as it applies to Y-Chromosome testing and genealogy. Technical terms are defined in this same context. DNA Deoxyribonucleic acid (DNA) is the chemical inside the nucleus of all cells that carries the genetic instructions for making living organisms. A DNA molecule consists of two strands that wrap around each other to resemble a twisted ladder. The sides are made of sugar and phosphate molecules. The “rungs” are made of nitrogen-containing chemicals called bases. Each strand is composed of one sugar molecule, one phosphate molecule, and a base. Four different bases are present in DNA - adenine (A), thymine (T), cytosine (C), and guanine (G). The particular order of the bases arranged along the sugar - phosphate backbone is called the DNA sequence; the sequence specifies the exact genetic instructions required to create a particular organism with its own unique traits.  Each strand of the DNA molecule is held together at its base by a weak bond. The four bases pair in a set manner: Adenine (A) pairs with thymine (T), while cytosine (C) pairs with guanine (G). These pairs of bases are known as Base Pairs (bp).  These Base Pairs (bp) are the basis of Y-chromosome testing. . . . . . Genealogy It's not a hobby, it's an obsession	...	Meiosis The two sequential division processes of meiosis culminates in the production of gametes with only half the number of chromosomes of somatic cells.  As a result, human sperm and ova each have only 23 single-stranded chromosomes.     For summary of reduction division in meiosis click here.              http://anthro.palomar.edu/biobasis/bio_2.htm   Chromosomes Chromosomes are paired threadlike "packages" of long segments of DNA contained within the nucleus of each cell. In humans there are 23 pairs of chromosomes. In 22 pairs, both members are essentially identical, one deriving from the individual's mother, the other from the father. The 23rd pair is different. In females this pair has two like chromosomes called "X". In males it comprises one "X" and one "Y," two very dissimilar chromosomes. It is these chromosome differences which determine sex. The Y-Chromosome Human sex is determined by the X and Y chromosomes. A female has 2 X-Chromosomes and a male has an X and a Y-Chromosome. When a child is conceived it gets one chromosome from its mother and one chromosome from its father. The chromosome from the mother will always be an X, but the chromosome from the father may be either X or Y. If the child gets the X she will be a girl, if the child gets the Y he will be a boy. This Y-Chromosome has certain unique features:  The presence of a Y-Chromosome causes maleness. This little chromosome, about 2% of a father's genetic contribution to his sons, programs the early embryo to develop as a male.  It is transmitted from fathers only to their sons.  Most of the Y-Chromosome is inherited as an integral unit passed without alteration from father to sons, and to their sons, and so on, unaffected by exchange or any other influence of the X-Chromosome that came from the mother. It is the only nuclear chromosome that escapes the continual reshuffling of parental genes during the process of sex cell production. It is these unique features that make the Y-Chromosome useful to genealogists.	...
		http://en.wikipedia.org/wiki/Haplotype   (Reference  - Haplogroups) http://www.kerchner.com/cgi-kerchner/ystrmutationrate.cgi  Mutation Rates In Surname Project) http://en.wikipedia.org/wiki/Haplogroup_R1b_(Y-DNA) (Iberian origins.) http://www.isogg.org/uk.htm    (United Kingdom & European Resources) Example of DNA Backbone: 5'-d(CGAAT):

Reading the Test Results 

The table below is used to show our DNA test results. It shows 12 of the 25 markers that most of the participants test.

The numbers (1-12) across the top of the table are the marker numbers. They have no significance other than as an easy way to refer to the marker. Note: FamilyTree DNA refers to these numbers as Locus. The second set of numbers across the top of the matrix are DYS# (the actual marker names). 

The numbers down the left side of the table identify the participant in the DNA project availabe to each participant and Project Administrator. The numbers down the right side of the table identify the participant's oldest known ancestor (Not available at this time).

The rest of the numbers are the Allele (the number repeats) for each participant at the specified marker.

R1b1c6  Haplogroup is the most common group in European populations. It is believed to have expanded throughout Europe as humans re-colonized after the last glacial maximum 10-12K yrs ago.  R1b halogroup's final destination of its genetic journey began some 60,000 yrs ago with an ancient "y" chromosome marker.   The Haplogroup R1b1c6 positive. M167 aka SRY2627 R1b1c6 subclade  most likely originated in Spain. In the website RootsPath Index we look to the oldest known Ydna ancestor Ricardo Ramos born in Bavispe, Sonora, Mexico in 1889 - and died 1977 in Douglas, Arizona. Ricardo inspired the research by this writer. Further comparative information can be found at  Population Structure in the Mediterranean Basin: A "Y" Chromosome Perspective.

Ricardo Montaño Ramos of  Bavispe, Sonora Mexico, Haplogroup R1b M167 aka SRY2627 R1b1c6 positive. See this information on the migration of the - M167 aka SRY2627 R1b1c6 subclade in Spain where this mutation likely originated. See a DNA match to haplotype 145 -  A "Y" Chromosome Perspective.

        

Terminology Glossary   Additional DNA Study

Adenine

Designated by the letter A, is a purine base. One of the four base molecules present in DNA.

Allele

One of several forms of a gene that can exist at a single location (marker) on a chromosome. When STR's are measured on the Y-chromosome, this corresponds to a different number of repeat units. For example, for DYS19 where TAGA is the repeat unit, different alleles could be 13, 14, 15 repeats of the TAGA unit etc. A father will pass his Y-chromosome on to his son and thus the son will inherit the same alleles (i.e. no. of repeat units). Alleles will be changed if miscopied, resulting in a mutation. Some alleles are more common in particular populations

Autosome

A chromosome not involved in sex determination. The human genome consists of 46 chromosomes, 22 pairs of autosomes (numbered 1-22), and one pair of sex chromosomes (the X and Y chromosomes).

Base

In DNA, this can be either adenine (A), cytosine (C), guanine (G) or thymine (T). They are derived from either purine or pyrimidine.

Base-pair

Two complementary bases joined by hydrogen bonds usually as part of the DNA molecule; base-pairing occurs between (purines and pyrimidines) i.e. between A and T and between G and C.

Base sequence

The order of nucleotide bases in a DNA molecule e.g. AGTACGTA etc.

Chromosomes

Chromosomes are bundles of tightly coiled DNA. Humans have 23 paired chromosomes (22 pairs of autosomes and a single pair of sex chromosomes). A single chromosome of each pair is passed from each parent to child. Each chromosome is formed when the DNA strand combines with lots of small proteins called histones. The DNA and histones automatically wrap themselves up into a shape that looks like an elongated letter X.

Complementary sequences

DNA is made up of two long strands connected together along the middle (a bit like a zip), where bases on one strand are bonded to bases on the other side. If the base sequence is G-T-A-C on one side, the other side is always C-A-T-G, thus complementing each other.

Cytosine

Designated by the letter C, it is a pyrimidine base. One of the four base molecules present in DNA.

DNA

DeoxyriboNucleic Acid. The genetic material of organisms, usually double-stranded; a class of nucleic acids identified by the presence of phosphate, deoxyribose (a sugar), and the four bases. Often forms the familiar double-helix. Within DNA are the code-words needed to form proteins, although much of the DNA is termed 'junk DNA' and has no known function.

DYS

D = DNA: Y = Chromosome; S = Single copy sequence. The DYS numbering scheme (e.g. DYS388, DYS390) for the Y-STR haplotype markers are controlled and administered by an international standards body called HUGO - Human Gene Nomenclature Committee - based at University College, London.

Double helix

The familiar shape that two linear strands of DNA with complementary sequences assume when bonded together.

Enzyme

A protein that can speed up a specific chemical reaction without being changed or consumed in the process.

Gene

The functional and physical unit of heredity passed from parent to offspring; a sequence of DNA nucleotides on a chromosome.

Genetic genealogy

The new field of family history research utilizing the Y-chromosome and mtDNA to prove or disprove biological connections. The Y-chromosome links the strictly paternal line (father to son), whilst mtDNA links the mother to offspring line (mother to sons and daughters). For the vast majority of family history studies, the Y-chromosome is studied.

Genetics

The study of the patterns of inheritance of specific traits.

Genome

All the genetic material in the chromosomes of a particular organism; its size is generally given as the total number of base-pairs. In humans, 46 chromosomes make up the genome, with a total of 3 billion bases pairs of approx. 2 meters in length packaged into a tiny nucleus.

Genome projects

Research and technology development efforts aimed at mapping and sequencing some or all of the genome of an organism. The improvements and lower cost of technology that genome projects have brought make possible the new field of genetic genealogy for genealogists.

Genotype

The actual alleles present in an individual.

Guanine

Designated by the letter G, it is a purine base. One of the four base molecules present in DNA.

Haplotype

The set of repeat values obtained from Dna Markers...  Your Y-DNA haplotype is a set numbers, each number representing your allele at a given STR marker. Two or more haplotypes may be compared as a check for a genetic relationship.

Haplogroup

Haplogroups are large groups that can be used to define genetic populations and are often geographically orientated. For example, when the Y-chromosome is tested, many males who live along the western coasts of Europe belong to Haplogroup R1b (used to be called HG1), which belies the historical movement of males along that coast. One way to think about haplogroups is that a haplogroup is a branch on the tree of Homo Sapiens and a haplotype represents the leaves of the tree. All the haplotypes that belong to a haplogroup are leaves on the same branch. The Y-chromosome haplogroup of an individual is not defined by their haplotype (because haplotypes are determined by STR markers). Instead, they are determined by SNP's (single nucleotide polymorphisms) where a single base changes e.g. from A to G. These happen so rarely as to be considered unique. However, there is a strong correlation between haplogroups and haplotypes so given any particular haplotype, it may be possible to correctly determine the haplogroup without any further tests.

Haplotype diversity

A measure of the uniqueness of a particular haplotype in a given population.

Heredity

The transmission of characteristics (hair color, facial features, genetic disorders etc.) from one generation to the next.

Junk DNA

Most of the DNA in our bodies is termed ‘junk DNA’. It is non-coding (isn’t used for making proteins) and thus does not control medical function but is probably involved in genomic organization. Genetic genealogy only looks at the markers within junk DNA and thus the Y-DNA test cannot derive any medical information.

Locus (pl. loci)

Latin for place. See marker.

Marker

Also called a Locus (pl. loci). A gene of a known location on a chromosome. See STR marker. FTDNA  Y-DNA tests use 12, 25, or 37 STR markers.

Microsatellite

See STR marker.

Mitochondrial DNA

mtDNA - The circular DNA contained inside the mitochondria. The mitochondria are small organelles residing in animal cells which provide the power to the cell. They occupy about one-fifth of each cell. The mtDNA is passed from mother to her offspring (both sons and daughters), but only the daughter will pass it on. The DNA sequence can be read and compared against a standard sequence (the Cambridge Reference Sequence) and deep (i.e. several thousands of years), but very broad genealogies can be deduced. An mtDNA haplogroup can usually be assigned for any given sequence.

Modal

Statistical term - meaning the value at which an absolute or maximum occurs in the frequency distribution of the variate.

Modal Haplotype

Any person who exactly matches the alleles found to be most common (Modal) among the descendants of a person. A person who matches 20 alleles while being 1 allele off in only 1 locus will be considered to be in the haplogroup, rather than in the family haplotype.

MRCA

The Most Common Recent Ancestor between two people. For example, for two 1st cousins, their shared grandparent is the MRCA. If the cousins were both boys, they would share their grandfather’s Y-chromosome.

mtDNA

See Mitochondrial DNA

Multiplex reaction

Used in the PCR method, it utilizes a ‘cocktail’ of chemicals so that many different markers (or loci) may be copied and tagged at the same time.

Mutations and Mutation Rates

~  Any inheritable change in DNA sequence. Mutations usually occur as a result of miscopying by cell enzymes. Because the Y-chromosome has relatively few regions that control genetic function and is mostly ‘junk-DNA’, mutations in this 'junk DNA' cause no adverse effects and can therefore occur quite frequently.   ~~Mutation Rate: The rate at which a genetic marker mutates or changes over time. The number of mutations per hundreds of generations expressed as a decimal value or a percentage. For example: A typical mutation rate used in early Y chromosome STR (Y-STR) TMRCA calculations and analysis is one per 500 generations (transmission events). That would be an average mutation rate (Y-STR Genetic Clock Mutation/Tick Rate) of .002 or 0.2%. Some commercial DNA testing labs are using an average Y-STR mutation rate of .003 or 0.3%. And a recent study by FamilyTreeDNa indicates that the average mutation rate for all Y-STR markers for the male population as a whole may be twice as fast as the historical standard rate, i.e., .004 or 0.4% instead of .002 or 0.2%.   http://www.kerchner.com/dnamutationrates.htm A mutation at an STR marker may cause a particular allele to change from 11 repeats to 12 repeats – the son will therefore carry the 12 allele.

The estimated rate of mutational change is estimated to be approximately one mutation per 500 transmission events (0.002) for any given STR marker. However, these changes are random and thus can take place at any time.

Nucleic acid

DNA and RNA are both nucleic acids. They are long polymer structures made up of nucleotides.

Nucleotide

A single unit of nucleic acid. In DNA they are composed of phosphate, deoxyribose (a sugar), and either a purine (for adenine and guanine) or pyrimidine (for cytosine and thymine) base.

Nucleus

The central structure of a cell that contains the genetic material.

PCR

Polymerase Chain Reaction - A process carried out in a test tube that produces millions of copies of small sections of DNA. Using a heat resistant enzyme (DNA polymerase) and a mixture of other chemicals, cycles of hot and cold temperatures essentially photocopy a particular marker (or locus) of the DNA many times. Fluorescent tags are added to each copy so that they may be detected using laser analyzers. A technique called multiplexing enhances the process.

Point Mutation

A change in a single base pair.

Population

A group of individuals residing in a given area at a given time.

REO

The Recent Ethnic Origin information is provided by each testee, and is only as accurate as the testee's knowledge. FTDNA instructs testees to answer "Unknown Origin" when their ancestor's origin is uncertain or not known.

Restriction enzyme

A protein that recognizes specific, short nucleotide sequences and cuts DNA at those sites. Bacteria contain over 400 such enzymes that recognize and cut over 100 DNA sequences. Snake venoms are sometimes also used.

Sequencing

Determination of the order of nucleotides (base sequence) in a DNA or RNA molecule or the order of amino acids in a protein.

Sex chromosomes

X and Y-chromosomes - Chromosomes involved in sex determination. Females have two X chromosomes, males have one X and one Y-chromosome. The Y-chromosome is thus only found in males.

SNP

Single Nucleotide Polymorphisms. An SNP test is used to confirm your haplogroup.

STR marker

Short Tandem Repeats marker - A stretch of DNA where a small base sequence (usually 2-6 base-pairs) repeats itself several times, giving a particular allele. For example, at the STR marker DYS391, the base sequence may read TCTA TCTA TCTA TCTA TCTA TCTA TCTA TCTA where TCTA is repeated eight times. Choosing markers that have been proven to have high variation between and within populations is desirable.

Thymine

Designated by the letter T, it is a pyrimidine base. One of the four base molecules present in DNA.

TMRCA

Term used by population geneticists indicates the Time to the Most Recent Common Ancestor.

Transmission event

The effective passing on of the Y-chromosome.

Y-DNA

Non-recombining DNA determines whether a child will be a male or female. Y-DNA passes from father to son almost unaltered for long periods of time. It is approx. 60 million base-pairs long.

Coat Of Arms ~  Early Arrivals ~ 7 Gold Cities ~ Understanding DNA ~ Fam Tree Gallery ~ Feedback ~ Index